pCMV- Tet3G/ pCMV- Tet3G质粒/ pCMV- Tet3G Plasmid

pCMV-Tet3G

PVT11010  2ug

 

pCMV-Tet3G Description

pCMV-Tet3G is a Mammal plasmid.

 

pCMV-Tet3G Informaiton

Promoter: CMV

Replicon: pUC ori, SV40 ori

Terminator: SV40 poly (A) signal

Plasmid classification: mammalian cells, tetracycline regulatory system vectors

Plasmid size: 7139bp

Prokaryotic resistance: Amp

Clonal strain: DH5 alpha

Culture conditions: 37 C, aerobic LB

Expression host: lactation cells

Induction: tetracycline induction

5'sequencing primers: CMV-F:CGCAAATGGGCGGTAGGCGTG

Primers for 3'sequencing: primers designed based on sequences

 

pCMV-Tet3G Introduction

pCMV-Tet3G Vector expresses Tet-On® 3G, a tetracycline-controlled transactivator that exhibits high activity in the presence of the inducer doxycycline (Dox) and exceptionally low activity in its absence. Tet-On 3G results from the fusion of amino acids 1–207 of a mutant Tet repressor (TetR) to 39 amino acids that form three minimal "F"-type transcriptional activation domains from the herpes simplex virus VP16 protein. Tet-On 3G was derived from Tet-On Advanced (1–4); as a result, it’s fully synthetic, lacks cryptic splice sites, and is codon-optimized for stable expression in mammalian cells. Compared to both of its predecessors, this 3rd generation Tet-On transactivator demonstrates increased sensitivity to Dox (1). Constitutive expression of Tet-On 3G is driven by the human cytomegalovirus immediately early promoter (PCMV IE). Note: An EF1α version of this vector is available for cell lines in which the CMV promoter is silenced. pCMV-Tet3G is used to develop stable Tet-On 3G cell lines, which are hosts for Tet-inducible gene expression systems. To create a Tet-inducible expression system, a vector containing a gene of interest under the control of the Tet-inducible TRE3G promoter (PTRE3G) is transfected into a Tet-On 3G cell line. The addition of Dox to the system causes Tet-On 3G to undergo a conformational change that allows it to bind to PTRE3G, activating transcription of the gene of interest in a highly dose-dependent manner.

 

pCMV-Tet3G Multiple cloning site

 

 

 

pCMV-Tet3G Sequence