pBI121- EGFP/ pBI121- EGFP质粒/ pBI121- EGFP Plasmid

pBI121-EGFP

Search name

pBI121-EGFP,Plasmid pBI121-EGFP,pBI121-EGFP vector

 

pBI121-EGFP Information

Promoter: CaMV 35S

Replicon: oriV

Terminator: NOS

Plasmid classification: plant series, protein overexpression vector

Plasmid size: 13832bp

Plasmid label: N-10*His, N-EGFP, C-6*His

Prokaryotic resistance: Kan

Screening markers: Neo

Cloned strain: DH5 alpha

Culture conditions: 37 centigrade, aerobic LB

5'sequencing primers: 35S:GACGCACAATCCCACTATCC

3'sequencing primers: primers designed according to sequence

Use: Plant expression

 

pBI121-EGFP Description

pBI121-EGFP is transformed from pBI121 and EGFP label. It is a plant expression vector with Kanamycin kanamycin resistance and can be transformed into Escherichia coli DH5 alpha. A large number of replication and amplification are screened by Kan. The culture condition is LB, 37. The promoter of the pBI121-EGFP carrier is 35S, which can be mediated by Agrobacterium tumefaciens to express EGFP green fluorescent protein in plant cells, and the label has N-10*His, N-EGFP, C-6*His, and can be purified with nickel column. The enzyme sites of pBI121-EGFP include XhoI, NcoI, SalI, SpeI, XbaI, SmaI, BamHI, SacI, EcoRI, which can be selected according to needs.

 

 

pBI121-EGFP Sequence