pEGFP- N3/ pEGFP- N3质粒/ pEGFP- N3 Plasmid

pEGFP-N3

PVT1204 2ug

Search name

pEGFP-N3,Plasmid pEGFP-N3,pEGFP-N3 vector

 

pEGFP-N3 Information

 

Promoter: CMV

Replicon: pUC ori

Terminator: SV40 poly (A) signal

Plasmid size: 4729 BP

Prokaryotic resistance: kanamycin Kan

Screening Marker: Hereditary Mycin G418

Cloning strain: Escherichia coli DH5alpha

Culture conditions: 37 C, aerobic, LB

Expression host: mammalian cells

Induction mode: no induction, transient expression

5'Sequencing Primers: CMV-F: CGCAAATGGGGGGGTAGGGGGGTG

3'Sequencing Primers: Designing Primers Based on Sequences

 

pEGFP-N3 Description

pEGFP-N3 encodes a red-shifted variant of wild-type GFP (1–3) which has been optimized for brighter fluorescence and higher expression in mammalian cells. (Excitation maximum = 488 nm; emission maximum = 507 nm.) pEGFP-N3 encodes the GFPmut1 variant (4) which contains the double-amino-acid substitution of Phe-64 to Leu and Ser-65 to Thr. The coding sequence of the EGFP gene contains more than 190 silent base changes which correspond to human codon-usage preferences (5). Sequences flanking EGFP have been converted to a Kozak consensus translation initiation site (6) to further increase the translation efficiency in eukaryotic cells. The MCS in pEGFP-N3 is between the immediate early promoter of CMV (PCMV IE) and the EGFP coding sequences. Genes cloned into the MCS will be expressed as fusions to the N terminus of EGFP if they are in the same reading frame as EGFP and there are no intervening stop codons. SV40 polyadenylation signals downstream of the EGFP gene direct proper processing of the 3' end of the EGFP mRNA. The vector backbone also contains an SV40 origin for replication in mammalian cells expressing the SV40 T-antigen. A neomycin resistance cassette (Neor), consisting of the SV40 early promoter, the neomycin/kanamycin resistance gene of Tn5, and polyadenylation signals from the Herpes simplex virus thymidine kinase (HSV TK) gene, allows stably transfected eukaryotic cells to be selected using G418. A bacterial promoter upstream of this cassette expresses kanamycin resistance in E. coli. The pEGFP-N3 backbone also provides a pUC origin of replication for propagation in E. coli and an f1 origin for single-stranded DNA production.

 

pEGFP-N3 Sites

 

pEGFP-N3 Sequence