pHiL- D2/ pHiL- D2质粒/ pHiL- D2 Plasmid

pHiL-D2

Search name

pHiL-D2,Plasmid pHiL-D2,pHiL-D2 vector

 

pHiL-D2 Information

Bacterial Resistance:

Promoter: AOX1

Replicator: pUC ori, FI ori

Plasmid size: 8210bp

Prokaryotic resistance: Amp

Screening markers: HIS4

Cloned strain: DH5 alpha

Culture conditions: 37 centigrade, aerobic LB

Expression host: yeast cells

Culture conditions: 28 C, YPD

5'sequencing primers: AOX5:GACTGGTTCCAATTGACAAGC

3'sequencing primers: AOX3:GGCAAATGGCATTCTGACAT

 

pHiL-D2 Description

1. the size of pHIL-D2 carrier is 8210 BP, which is a fusion expression vector.

In the 2. vector construction, the single restriction endonuclease loci available for EcoR I.

The protein gene of 3. intracellular expression.

4. in the process of vector construction, we need to start the gene codon ATG.

5. Pichia pastoris was screened by HIS4.

6. in order to insert the gene into the AOX region of GS115 or KM71, the SacI restrictive endonuclease linearized plasmids (His+Mut+ genotypes in GS115 and His+ MutS genotype in KM71) were used to insert the gene into GS115 or KM71 His4 regions. To produce His+ MutS genotype) insert the gene into the AOX1 region of GS115, and use Bgl II to linearize the plasmid (producing His+MutS genotype).

 

pHiL-D2 Sequence